
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rbb4
- Ensembl ID:
- ENSDARG00000029058
- ZFIN ID:
- ZDB-GENE-030131-445
- Description:
- Histone-binding protein RBBP4 [Source:UniProtKB/Swiss-Prot;Acc:Q6P3H7]
- Human Orthologue:
- RBBP4
- Human Description:
- retinoblastoma binding protein 4 [Source:HGNC Symbol;Acc:9887]
- Mouse Orthologue:
- Rbbp4
- Mouse Description:
- retinoblastoma binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1194912]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15025 | Nonsense | Available for shipment | Available now |
sa23554 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15025
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000048144 | Nonsense | 22 | 424 | 2 | 12 |
ENSDART00000130326 | Nonsense | 22 | 444 | 2 | 13 |
The following transcripts of ENSDARG00000029058 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 32250432)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 31417721 GRCz11 19 31005034 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGCTGCATTTGATGACGCGGTGGAGGAGAGRGTGATAAATGAAGAATAT[A/T]AAATATGGAAGAAAAACACTCCGTTTCTKTACGATCTGGTGATGACCCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23554
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000048144 | Nonsense | 235 | 424 | 6 | 12 |
ENSDART00000130326 | Nonsense | 235 | 444 | 6 | 13 |
The following transcripts of ENSDARG00000029058 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 32247007)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 31414296 GRCz11 19 31001609 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAAAAACTATTTTCACTGGTCACACTGCTGTAGTGGAGGATGTGTCCTG[G/A]CACCTGCTGCATGAGTCTCTCTTCGGGTCTGTTGCAGATGACCAAAAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: