zgc:77724

Ensembl ID:
ENSDARG00000029043
ZFIN ID:
ZDB-GENE-040426-2292
Description:
Nucleoporin-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0U9]
Human Orthologue:
NUPL2
Human Description:
nucleoporin like 2 [Source:HGNC Symbol;Acc:17010]
Mouse Orthologue:
Nupl2
Mouse Description:
nucleoporin like 2 Gene [Source:MGI Symbol;Acc:MGI:2387631]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36745 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050125 Nonsense 387 414 7 7
Genomic Location (Zv9):
Chromosome 19 (position 605722)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 627209
GRCz11 19 627018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTCAATCTGGACACGGTCTCTTCACAGCTAACAGCGAGCTAACTCCT[G/T]AAGAACTGAAGGAGTTCATGGCTAAACGCTTCACGCTAGGACAGATCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link