Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eif1axa
- Ensembl ID:
- ENSDARG00000029003
- ZFIN ID:
- ZDB-GENE-041010-185
- Description:
- eukaryotic translation initiation factor 1A, X-chromosomal [Source:RefSeq peptide;Acc:NP_001006082]
- Human Orthologues:
- EIF1AX, EIF1AY
- Human Descriptions:
- eukaryotic translation initiation factor 1A, X-linked [Source:HGNC Symbol;Acc:3250]
- eukaryotic translation initiation factor 1A, Y-linked [Source:HGNC Symbol;Acc:3252]
- Mouse Orthologues:
- AC079644.3, AC126554.1, BB287469, CT954323.1, Eif1a, Eif1ax, Gm2016, Gm2046, Gm4027, Gm5662, Gm8300
- Mouse Descriptions:
- eukaryotic translation initiation factor 1A Gene [Source:MGI Symbol;Acc:MGI:95298]
- eukaryotic translation initiation factor 1A, X-linked Gene [Source:MGI Symbol;Acc:MGI:1913485]
- eukaryotic translation initiation factor 1A-like 1 [Source:RefSeq peptide;Acc:NP_001171035]
- expressed sequence BB287469 Pseudogene [Source:MGI Symbol;Acc:MGI:3034635]
- predicted gene 2016 Gene [Source:MGI Symbol;Acc:MGI:3780185]
- predicted gene 2046 Gene [Source:MGI Symbol;Acc:MGI:3780214]
- predicted gene 4027 Gene [Source:MGI Symbol;Acc:MGI:3782201]
- predicted gene 5662 Gene [Source:MGI Symbol;Acc:MGI:3648257]
- predicted gene 8300 Gene [Source:MGI Symbol;Acc:MGI:3643794]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa15746 | Essential Splice Site | Available for shipment | Available now |
| sa33589 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15746
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000066645 | Essential Splice Site | 68 | 144 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25675654)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23502919 GRCz11 5 24006719 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGATGGGGTCAAACGGCTCTGCCACATCCGAGGGAAGCTCCGCAAAAAGG[T/C]ATGATGAAGTTAATAAYGACCATGTTATGGRTATGAAAGATTTATCATAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33589
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000066645 | Essential Splice Site | 143 | 144 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25672942)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23500207 GRCz11 5 24004007 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGATCCTGTTTGATGATATTGGAGAGAACGATGACGACATTGATGACG[T/A]AAGTTCAGAATTGTTTTTATCCAGCCTGATCTCACGGGAAAGCTTAAGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
