
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tekt2
- Ensembl ID:
- ENSDARG00000028973
- ZFIN ID:
- ZDB-GENE-040113-1
- Description:
- tektin 2 [Source:RefSeq peptide;Acc:NP_001017432]
- Human Orthologue:
- TEKT2
- Human Description:
- tektin 2 (testicular) [Source:HGNC Symbol;Acc:11725]
- Mouse Orthologue:
- Tekt2
- Mouse Description:
- tektin 2 Gene [Source:MGI Symbol;Acc:MGI:1346335]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13527 | Nonsense | Available for shipment | Available now |
sa23460 | Nonsense | Available for shipment | Available now |
sa25088 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa13214 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13527
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000046527 | Nonsense | 17 | 429 | 2 | 11 |
ENSDART00000059358 | Nonsense | 17 | 425 | 2 | 10 |
ENSDART00000135102 | None | 284 | 1 | 9 |
- Genomic Location (Zv9):
- Chromosome 19 (position 11268602)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 10727831 GRCz11 19 10646756 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATGGCCACCTTAAGCTCGAAGCCRGCCTCACGCTACAGTGTTTCTGACT[G/A]GGCAACWAACAATAAGCAAATSTCAGATACTGCTGAACACAAACGCAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23460
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000046527 | Nonsense | 161 | 429 | 4 | 11 |
ENSDART00000059358 | Nonsense | 161 | 425 | 4 | 10 |
ENSDART00000135102 | 16 | 284 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 19 (position 11265925)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 10725154 GRCz11 19 10644079 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGATGGAGCACAACGTGTCCTTCAACAGTGCATCGATCAGGCCTTTGAA[C/T]AGCTGTGGTAAGAACATTCAGATTTCAGGTTGGAAGCCCTCACTAGTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25088
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000046527 | Essential Splice Site | 215 | 429 | 6 | 11 |
ENSDART00000059358 | Essential Splice Site | 211 | 425 | 5 | 10 |
ENSDART00000135102 | Essential Splice Site | 70 | 284 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 19 (position 11264072)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 10723301 GRCz11 19 10642226 - KASP Assay ID:
- 554-7445.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAATCACCTGAGATCTCACTGAAGCCTAACCCTACAAGAGTGCCCCCTGG[G/A]TGAGTTTATGAGTAAACTATAAGCAAACATGCTATCTTTGCTTAATATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13214
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000046527 | Essential Splice Site | 290 | 429 | 9 | 11 |
ENSDART00000059358 | Essential Splice Site | 286 | 425 | 8 | 10 |
ENSDART00000135102 | Essential Splice Site | 145 | 284 | 7 | 9 |
- Genomic Location (Zv9):
- Chromosome 19 (position 11260340)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 10719569 GRCz11 19 10638494 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAATGTTTATTTATTTGTTGATATTTCGATATGTGGGCYSATATGTTTC[A/T]GACTCAAGATGAGATTGCTGAGCTGGAGAAGGATATCATTGGCYTGGAGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: