si:dkey-228b2.4

Ensembl ID:
ENSDARG00000028900
ZFIN ID:
ZDB-GENE-091117-46
Description:
ODF2 [Source:UniProtKB/TrEMBL;Acc:Q1WCB5]
Human Orthologue:
ODF2
Human Description:
outer dense fiber of sperm tails 2 [Source:HGNC Symbol;Acc:8114]
Mouse Orthologue:
Odf2
Mouse Description:
outer dense fiber of sperm tails 2 Gene [Source:MGI Symbol;Acc:MGI:1098824]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16482 Nonsense Available for shipment Available now
sa39320 Nonsense Mutation detected in F1 DNA During 2018
sa12576 Essential Splice Site Available for shipment Available now
sa12668 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022708 Nonsense 20 831 2 20
ENSDART00000081426 Nonsense 20 831 2 19
Genomic Location (Zv9):
Chromosome 21 (position 11331440)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13032805
GRCz11 21 13129793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGTGAGAACAAGGTCCTCCTCCCCACCCCTGCATGTGCAYGTGAAY[G/T]AGAGCACACCTGTGCATGTTCATGTGAAGAAGAGCACGAAATGCAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022708 Nonsense 648 831 16 20
ENSDART00000081426 Nonsense 648 831 16 19
Genomic Location (Zv9):
Chromosome 21 (position 11346508)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13047873
GRCz11 21 13144861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATAAATAAATCATGTTGTATTCTGGTGGATTGGGTATAGGCAGAGCAA[C/T]AGGGAAGCTTGGCGGAGATGTTGAGGCACAAAAACATGCTGCTACAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022708 Essential Splice Site 678 831 17 20
ENSDART00000081426 Essential Splice Site 678 831 17 19
ENSDART00000022708 Essential Splice Site 678 831 17 20
ENSDART00000081426 Essential Splice Site 678 831 17 19
Genomic Location (Zv9):
Chromosome 21 (position 11346800)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13048165
GRCz11 21 13145153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATAATGATGGAAGAAYTTTCRTTTTTGGGTTTTGATTTGCTCTTTTC[A/G]GGAAGCAAGAGGAGGCTAMYTCRCAAAATCGAGATCTCATCCAGGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022708 Essential Splice Site 678 831 17 20
ENSDART00000081426 Essential Splice Site 678 831 17 19
ENSDART00000022708 Essential Splice Site 678 831 17 20
ENSDART00000081426 Essential Splice Site 678 831 17 19
Genomic Location (Zv9):
Chromosome 21 (position 11346800)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13048165
GRCz11 21 13145153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATAATGATGGAAGAAYTTTCRTTTTTGGGTTTTGATTTGCTCTTTTC[A/G]GGAAGCAAGAGGAGGCTAMYTCRCAAAATCGAGATCTCATCCAGGTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link