
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:162848
- Ensembl ID:
- ENSDARG00000028899
- ZFIN ID:
- ZDB-GENE-070410-98
- Description:
- tektin-4 [Source:RefSeq peptide;Acc:NP_001139162]
- Human Orthologues:
- AC134878.1, AC145212.1, AL354822.1, CR392039.1, TEKT4
- Human Descriptions:
- tektin 4 [Source:HGNC Symbol;Acc:31012]
- Tektin-4 like protein LOC389833 [Source:UniProtKB/Swiss-Prot;Acc:Q8NAE5]
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B7WNX9]
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B7WNX9]
- Mouse Orthologue:
- Tekt4
- Mouse Description:
- tektin 4 Gene [Source:MGI Symbol;Acc:MGI:1919090]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa465 | Nonsense | Confirmed mutation in F2 line | During 2018 |
Mutation Details
- Allele Name:
- sa465
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049010 | Nonsense | 13 | 451 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 1 (position 55161533)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 53944472 GRCz11 1 54622123 - KASP Assay ID:
- 554-0197.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTACTCCAAATTATGATGTCTTCACAGATTCTAGTGTCTCGGCCTCATTA[T/G]GACACACGGGTCGTGGCGCAGAGTGGCTCACAGCCACCGGTGGAAAACCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: