zgc:162848

Ensembl ID:
ENSDARG00000028899
ZFIN ID:
ZDB-GENE-070410-98
Description:
tektin-4 [Source:RefSeq peptide;Acc:NP_001139162]
Human Orthologues:
AC134878.1, AC145212.1, AL354822.1, CR392039.1, TEKT4
Human Descriptions:
tektin 4 [Source:HGNC Symbol;Acc:31012]
Tektin-4 like protein LOC389833 [Source:UniProtKB/Swiss-Prot;Acc:Q8NAE5]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B7WNX9]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B7WNX9]
Mouse Orthologue:
Tekt4
Mouse Description:
tektin 4 Gene [Source:MGI Symbol;Acc:MGI:1919090]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa465 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa465
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049010 Nonsense 13 451 1 6
Genomic Location (Zv9):
Chromosome 1 (position 55161533)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53944472
GRCz11 1 54622123
KASP Assay ID:
554-0197.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTCCAAATTATGATGTCTTCACAGATTCTAGTGTCTCGGCCTCATTA[T/G]GACACACGGGTCGTGGCGCAGAGTGGCTCACAGCCACCGGTGGAAAACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link