si:dkey-29d8.1

Ensembl ID:
ENSDARG00000028878
ZFIN ID:
ZDB-GENE-070912-506
Description:
Novel protein similar to vasoactive intestinal peptide receptor 1 (Vipr1) [Source:UniProtKB/TrEMBL;A
Human Orthologues:
GHRHR, SCTR
Human Descriptions:
growth hormone releasing hormone receptor [Source:HGNC Symbol;Acc:4266]
secretin receptor [Source:HGNC Symbol;Acc:10608]
Mouse Orthologues:
Ghrhr, Sctr
Mouse Descriptions:
growth hormone releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95710]
secretin receptor Gene [Source:MGI Symbol;Acc:MGI:2441720]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32895 Nonsense Available for shipment Available now
sa8766 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046127 Nonsense 58 440 3 13
ENSDART00000135288 Nonsense 35 417 2 12
Genomic Location (Zv9):
Chromosome 2 (position 21039040)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21584978
GRCz11 2 21243040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCATTTCTTTGCTAAGGTTGCACAGGTGAATGGGATCTGGCGTGTTG[G/A]CCATCAGCTCGCATTGGAGAAGTAGTCACCATCCCCTGTCCAAACTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046127 Nonsense 256 440 8 13
ENSDART00000135288 Nonsense 233 417 7 12
Genomic Location (Zv9):
Chromosome 2 (position 21082241)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21628179
GRCz11 2 21286241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTGTGNNNNGCAGGAGTTCMAGGTGTCTTCATCACAATCT[G/A]GAGCATCACAAAAGCCTAWTTACATGATATCGGGTGAGGGAATGCAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link