zgc:55392

Ensembl ID:
ENSDARG00000028819
ZFIN ID:
ZDB-GENE-030131-5931
Description:
porcupine homolog [Source:RefSeq peptide;Acc:NP_956143]
Human Orthologue:
PORCN
Human Description:
porcupine homolog (Drosophila) [Source:HGNC Symbol;Acc:17652]
Mouse Orthologue:
Porcn
Mouse Description:
porcupine homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1890212]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27191 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007249 Essential Splice Site None 449 1 13
Genomic Location (Zv9):
Chromosome 8 (position 23411868)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22537299
GRCz11 8 22558538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTCATCCTACTTCCGGGTGTGAGCTTGTGCTGCTGCTGGAGATCGG[T/C]AAGAATCATGTGGAAGAGCAGCAGCGAGCGAATCTTCCTTCAAAATCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link