zgc:162945

Ensembl ID:
ENSDARG00000028815
ZFIN ID:
ZDB-GENE-030131-3975
Description:
hypothetical protein LOC560936 [Source:RefSeq peptide;Acc:NP_001122281]
Human Orthologue:
HARBI1
Human Description:
harbinger transposase derived 1 [Source:HGNC Symbol;Acc:26522]
Mouse Orthologue:
Harbi1
Mouse Description:
harbinger transposase derived 1 Gene [Source:MGI Symbol;Acc:MGI:2443194]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15143 Nonsense Available for shipment Available now
sa40916 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099586 Nonsense 215 351 3 4
Genomic Location (Zv9):
Chromosome 7 (position 31607423)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29999765
GRCz11 7 30270915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCTGGTTCAATGCAGGACAACCAAATTTTCGAGAAGTCAAAGTTATG[T/A]CAACGCTTTCAGCAAGGTACAGTWAAAACTGCAACTGTAGGCAGCACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099586 Nonsense 275 351 4 4
Genomic Location (Zv9):
Chromosome 7 (position 31607160)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29999502
GRCz11 7 30270652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCAAACCAGGCTCAAGATAGACAACACTTTAGCCATTTTAAAGGCC[C/T]GATTTAACTGTCTTCGTGACCTTAGAGTGTCACCCGAACGTGCGTCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link