si:dkey-283b15.4

Ensembl ID:
ENSDARG00000028800
ZFIN ID:
ZDB-GENE-100921-55
Human Orthologue:
CYTH2
Human Description:
cytohesin 2 [Source:HGNC Symbol;Acc:9502]
Mouse Orthologue:
Cyth2
Mouse Description:
cytohesin 2 Gene [Source:MGI Symbol;Acc:MGI:1334255]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19129 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11018 Essential Splice Site Available for shipment Available now
sa5885 Nonsense Mutation detected in F1 DNA During 2018
sa22743 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100848 Essential Splice Site 162 416 5 12
ENSDART00000140226 Essential Splice Site 162 416 5 12
ENSDART00000100848 Essential Splice Site 162 416 5 12
ENSDART00000140226 Essential Splice Site 162 416 5 12
Genomic Location (Zv9):
Chromosome 16 (position 6880071)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5724602
GRCz11 16 5624228
KASP Assay ID:
2260-9159.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGATCTTCACGAGTTCACAGATCTGAACTTGGTACAAGCACTTCGG[T/A]AAATCATTAATTCTTTATTGCATATCTTTATCCTAAACAATTGTATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100848 Essential Splice Site 162 416 5 12
ENSDART00000140226 Essential Splice Site 162 416 5 12
ENSDART00000100848 Essential Splice Site 162 416 5 12
ENSDART00000140226 Essential Splice Site 162 416 5 12
Genomic Location (Zv9):
Chromosome 16 (position 6880071)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5724602
GRCz11 16 5624228
KASP Assay ID:
2260-9159.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGGATCTTCACGAGTTCACAGATCTGAACTTGGTACAAGCACTTCGG[T/A]AAATCAKTAATTCTTTATTGCATATCTTTAWCCTAAACAATTGTATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100848 Nonsense 186 416 6 12
ENSDART00000140226 Nonsense 186 416 6 12
Genomic Location (Zv9):
Chromosome 16 (position 6880350)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5724881
GRCz11 16 5624507
KASP Assay ID:
554-3895.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGCCAGGYGAAGCTCAAAAAATCGACAGGATGATGGAGGCCTTCGCA[C/T]AGAGATACTGTCACTGCAATCCTGGAGTCTTCCAGAGCACAGGTNNCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100848 Nonsense 361 416 11 12
ENSDART00000140226 Nonsense 361 416 11 12
Genomic Location (Zv9):
Chromosome 16 (position 6889764)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5734295
GRCz11 16 5633921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAATAACCGCGGTCAGCTGATTAAAGCCTGTAAGACGGAGGCTGATGGT[C/T]GAGTGGTGGAGGGAAACCACATGGTGTACCGGATCTCTGCTCCCACCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link