
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tm9sf3
- Ensembl ID:
- ENSDARG00000028748
- ZFIN ID:
- ZDB-GENE-040426-2714
- Description:
- transmembrane 9 superfamily member 3 [Source:RefSeq peptide;Acc:NP_998554]
- Human Orthologue:
- TM9SF3
- Human Description:
- transmembrane 9 superfamily member 3 [Source:HGNC Symbol;Acc:21529]
- Mouse Orthologue:
- Tm9sf3
- Mouse Description:
- transmembrane 9 superfamily member 3 Gene [Source:MGI Symbol;Acc:MGI:1914262]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22233 | Nonsense | Available for shipment | Available now |
sa18308 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22233
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041609 | Nonsense | 48 | 586 | 2 | 15 |
- Genomic Location (Zv9):
- Chromosome 13 (position 9236078)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 9538698 GRCz11 13 9870721 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACACAGATAAAGAAGAGGTGGTTTTATGGATGAATACAGTGGGCCCTTA[T/A]CACAACCGACAGGAGACCTATAAGTACTTCTCCCTACCGTTCTGTGTGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18308
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041609 | Nonsense | 204 | 586 | 5 | 15 |
- Genomic Location (Zv9):
- Chromosome 13 (position 9231960)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 9534580 GRCz11 13 9866603 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GATCATCYCYACAGGTCAAGTGGAAGAAATCTGATGTGAAATTTGAGGAT[A/T]GAKTTGACAAATACCTTGATCCATCTKTYTTTCAACACAGAGTAAGTCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: