stat4

Ensembl ID:
ENSDARG00000028731
ZFIN ID:
ZDB-GENE-030616-264
Description:
signal transducer and activator of transcription 4 [Source:RefSeq peptide;Acc:NP_001004510]
Human Orthologue:
STAT4
Human Description:
signal transducer and activator of transcription 4 [Source:HGNC Symbol;Acc:11365]
Mouse Orthologue:
Stat4
Mouse Description:
signal transducer and activator of transcription 4 Gene [Source:MGI Symbol;Acc:MGI:103062]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25434 Nonsense Mutation detected in F1 DNA During 2018
sa21554 Essential Splice Site Available for shipment Available now
sa34719 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105764 Nonsense 3 742 1 23
ENSDART00000147052 Nonsense 3 731 2 24
Genomic Location (Zv9):
Chromosome 9 (position 42233411)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41358581
GRCz11 9 41160368
KASP Assay ID:
554-7355.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTATGACTACAATATAGTATGTTTCTTTTCCAGCATCACCATGAGT[C/T]AGTGGAAGCAAGTTCAGCAACTGGATATTAAGTTCCTCGAACAGGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105764 Essential Splice Site 343 742 10 23
ENSDART00000147052 Essential Splice Site 342 731 10 24
Genomic Location (Zv9):
Chromosome 9 (position 42261446)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41386616
GRCz11 9 41188403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAACCCCTCATCATCAAAACACAGGTGCAGTTCACCACCAAGGTCAG[G/A]TATGAACCACCGCTGAATCTTCCTGTAACTCTAAGTAAACAAGTCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105764 Nonsense 495 742 17 23
ENSDART00000147052 Nonsense 489 731 17 24
Genomic Location (Zv9):
Chromosome 9 (position 42271486)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41396656
GRCz11 9 41198443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTAGAACCTGGCCTTCTTCAGTAACCCGCTGCGGGCGAGCTGGAGT[C/T]AGCTCTCTGAGGTGCTCAGCTGGCAGTTCTCGAGTTTCGCAGGCCGAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link