macf1
- Ensembl ID:
- ENSDARG00000028533
- ZFIN ID:
- ZDB-GENE-030131-3606
- Description:
- Novel protein similar to vertebrate microtubule-actin crosslinking factor 1 (MACF1) [Source:UniProtK
- Human Orthologue:
- MACF1
- Human Description:
- microtubule-actin crosslinking factor 1 [Source:HGNC Symbol;Acc:13664]
- Mouse Orthologue:
- Macf1
- Mouse Description:
- microtubule-actin crosslinking factor 1 Gene [Source:MGI Symbol;Acc:MGI:108559]
Alleles
There are 19 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa12481 |
Nonsense |
Available for shipment |
Available now |
sa36881 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa12708 |
Nonsense |
Available for shipment |
Available now |
sa39255 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa36880 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa43318 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa36879 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa45679 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa15741 |
Nonsense |
Available for shipment |
Available now |
sa11432 |
Nonsense |
Available for shipment |
Available now |
sa13865 |
Nonsense |
Available for shipment |
Available now |
sa23566 |
Nonsense |
Available for shipment |
Available now |
sa36878 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa32250 |
Nonsense |
Available for shipment |
Available now |
sa17558 |
Nonsense |
Available for shipment |
Available now |
sa25094 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa36877 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa23565 |
Nonsense |
Available for shipment |
Available now |
sa43317 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa12481
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36770295)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35634815 |
GRCz11 |
19 |
35221935 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- YTCTTGTTTTCTGCTGTTTCCTCCTCTCTMTCTCTCTCTTCTCAGATGAA[C/T]GAGACCGGGTGCAAAAGAAAACTTTCACAAAATGGGTCAACAAACAWCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36881
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36742440)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35606960 |
GRCz11 |
19 |
35194080 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAGTCAGGTGACCTCACGGCGAAAGAGAAGCTGCTAATATGGAGTCAA[C/T]AGGCCACTGAGGGCTACCCCGGTCTACGCTGTACCAATTTCTCCTCCAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12708
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36732705)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35597225 |
GRCz11 |
19 |
35184345 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTGGTAGCCATGTCCTCCTCTGAGGATGAAGGCAGTCTGCGCTTTATTTA[T/A]GAGCTGCTGGGATGGGTWGAAGAAAMGCAAGATCTGCTGGAGCGAGCTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39255
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 19 (position 36708007)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35572527 |
GRCz11 |
19 |
35159647 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACCAGCTTACAGACAGGTGGAGTGGAGTCCGCAGGCAGATGGAGACACG[G/A]TGAGTCCTTCACAAGACTATTATCATGTGGGTTGTTGACATGGTTTTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36880
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36694671)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35559191 |
GRCz11 |
19 |
35146311 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTTACATAATGTGAACTTACAAGAGAAAGTTTTGCCATCAGAAAAGTA[T/G]AAAGAATCCAGGATTAAGGAAGACGAGACTGCAAGCAAGAAGACCAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43318
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36694115)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35558635 |
GRCz11 |
19 |
35145755 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAAAGATAAAACAGACAGGAAGAAACTTGATATGAGTAGGAGTTGTGAA[C/T]AAGCTAAGGAAAGACTTTCCTCATTGACAGGCACAAAAAGCCCATTTATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36879
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36693437)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35557957 |
GRCz11 |
19 |
35145077 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAAATTTGAGAATATGCCTATGGAACGACAGCAGGGTGATCTTGAAATT[A/T]AAGGTGCCGGCCATATGAGAAAAGATGGGCTTGAAACAGAGATCTTTCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45679
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36692888)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35557408 |
GRCz11 |
19 |
35144528 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAACAAGGAACACATGCTAAAAGAAAAAAAAACGGGAGGTCATGGTTTT[G/T]AGGCAGAAGCTGAGGAAATGAAGGACAGCAAGACAGATGGATTTGATGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15741
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36691341)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35555861 |
GRCz11 |
19 |
35142981 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAGRTTATGCCAGAGTCTGATAACACGCAAAAGGAAGTGGTGGAAGAATA[T/A]CCAATGGGTTCAGTGGAGAGACAACCTGAAGTTCTTCAAGTTAATATTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11432
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36689153)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35553673 |
GRCz11 |
19 |
35140793 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATGATGCCAGAGCAGAGGCACTATTAGCCCARCAGATGAGAGAGCATGAA[C/T]GACTGAAGAAAGAACAGAAAGWGAAAGAAGAGAAAATGGAAAAAGAGAGW
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13865
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36669821)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35534341 |
GRCz11 |
19 |
35121461 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAACTGGGGAGATCCGCTCGGAACTGGAACAAAGACGGGGACAATTGTCC[C/T]ARGCTGAACAGCTGTGTACGGAGCTCAGCGCAATTGTGGCTGAACCATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23566
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36669767)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35534287 |
GRCz11 |
19 |
35121407 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGAACAGCTGTGTACGGAGCTCAGCGCAATTGTGGCTGAACCATATCTC[A/T]GAGACGAGTTGCACAAGAGACTGGAAAGCGTGAGCGGCCCCCTCAAGAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36878
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36667807)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35532327 |
GRCz11 |
19 |
35119447 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCATCTCTCCTGGCATCCCTTCCTGCGGGAGATGAGCGGTTAGCCTTA[C/T]AGACTCGCTTGAACAACTTACGGCAAGACTGGGAGGTCTTAAACCAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32250
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36667288)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35531808 |
GRCz11 |
19 |
35118928 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCATCAGATCGAGGTTCAAGAGGCGCTTGGACCACAAGCTTGTAGCAAC[A/T]AAAGCCTGGAGCGTCTGCGAAGCCAACAGGAGCTGTTAAACTCTGTACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17558
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36630534)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35495054 |
GRCz11 |
19 |
35082174 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGGCTAGCTGAGGTGGCCCAGAGACTGGCTGAGGTCTCAGTSCAGAGTTA[T/A]CAGCCGGAGCWCCTAGAGCAGCAGCACAAACACACACTGGTATGATTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25094
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36626874)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35491394 |
GRCz11 |
19 |
35078514 |
- KASP Assay ID:
- 554-7690.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGTTGCTGATGCCAATCAGCGATACCGCCAAGCAGACGAGACCATCACA[C/T]AGAGAGTGCAGTTAGTGCAGGCTGCCATCCAAAGGTCACAGCAGGTACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36877
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 19 (position 36621414)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35485934 |
GRCz11 |
19 |
35073054 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTAGTGTGCTGTATGTGCTCTGACCATCGTCATCTCTCTATCATTTCA[G/T]TTTCATGATAAGATGGACCCTCTGTTGGAGACTCTGGAAGGCGCAGTCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23565
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 36618359)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35482879 |
GRCz11 |
19 |
35069999 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCCATTAAAGCAGAGACAGATGGGCTGAGGGAGGAACTGGAGATCGTA[C/T]GAACACTCGGAGCTGACCTCATCTTTGCCTGCGGAGAGACTGAAAAACCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43317
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 19 (position 36609092)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
35473612 |
GRCz11 |
19 |
35060732 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCCCTGTCCGTTTCAAAGCAGACGCGCCTCCAGCAGGCTCTTAAACAGG[T/C]ACGGCTGACCCTTATTTACACTTCTATTGTAATGCTTTTGAAAGACGTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: