ENSDARG00000028533 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

macf1

Ensembl ID:: ENSDARG00000028533
ZFIN ID:: ZDB-GENE-030131-3606
Description:: Novel protein similar to vertebrate microtubule-actin crosslinking factor 1 (MACF1) [Source:UniProtK
Human Orthologue:: MACF1
Human Description:: microtubule-actin crosslinking factor 1 [Source:HGNC Symbol;Acc:13664]
Mouse Orthologue:: Macf1
Mouse Description:: microtubule-actin crosslinking factor 1 Gene [Source:MGI Symbol;Acc:MGI:108559]

Alleles

There are 19 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa12481	Nonsense	Available for shipment	Available now
sa36881	Nonsense	Mutation detected in F1 DNA	During 2018
sa12708	Nonsense	Available for shipment	Available now
sa39255	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa36880	Nonsense	Mutation detected in F1 DNA	During 2018
sa43318	Nonsense	Mutation detected in F1 DNA	During 2018
sa36879	Nonsense	Mutation detected in F1 DNA	During 2018
sa45679	Nonsense	Mutation detected in F1 DNA	During 2018
sa15741	Nonsense	Available for shipment	Available now
sa11432	Nonsense	Available for shipment	Available now
sa13865	Nonsense	Available for shipment	Available now
sa23566	Nonsense	Available for shipment	Available now
sa36878	Nonsense	Mutation detected in F1 DNA	During 2018
sa32250	Nonsense	Available for shipment	Available now
sa17558	Nonsense	Available for shipment	Available now
sa25094	Nonsense	Mutation detected in F1 DNA	During 2018
sa36877	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa23565	Nonsense	Available for shipment	Available now
sa43317	Essential Splice Site	Mutation detected in F1 DNA	During 2018

Mutation Details

Allele Name:: sa12481
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	34	7964	2	97
ENSDART00000140075	Nonsense	77	1586	2	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36770295)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35634815
GRCz11	19	35221935

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

YTCTTGTTTTCTGCTGTTTCCTCCTCTCTMTCTCTCTCTTCTCAGATGAA[C/T]GAGACCGGGTGCAAAAGAAAACTTTCACAAAATGGGTCAACAAACAWCTC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa36881
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	164	7964	6	97
ENSDART00000140075	Nonsense	207	1586	6	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36742440)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35606960
GRCz11	19	35194080

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GTGAGTCAGGTGACCTCACGGCGAAAGAGAAGCTGCTAATATGGAGTCAA[C/T]AGGCCACTGAGGGCTACCCCGGTCTACGCTGTACCAATTTCTCCTCCAGC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa12708
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	553	7964	14	97
ENSDART00000140075	Nonsense	596	1586	14	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36732705)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35597225
GRCz11	19	35184345

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CTGGTAGCCATGTCCTCCTCTGAGGATGAAGGCAGTCTGCGCTTTATTTA[T/A]GAGCTGCTGGGATGGGTWGAAGAAAMGCAAGATCTGCTGGAGCGAGCTGA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa39255
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Essential Splice Site	1228	7964	27	97
ENSDART00000140075	Essential Splice Site	1271	1586	27	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36708007)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35572527
GRCz11	19	35159647

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CACCAGCTTACAGACAGGTGGAGTGGAGTCCGCAGGCAGATGGAGACACG[G/A]TGAGTCCTTCACAAGACTATTATCATGTGGGTTGTTGACATGGTTTTGCA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa36880
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > G
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	2696	7964	35	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36694671)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35559191
GRCz11	19	35146311

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CCTTTACATAATGTGAACTTACAAGAGAAAGTTTTGCCATCAGAAAAGTA[T/G]AAAGAATCCAGGATTAAGGAAGACGAGACTGCAAGCAAGAAGACCAACAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa43318
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	2882	7964	35	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36694115)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35558635
GRCz11	19	35145755

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AAAAAGATAAAACAGACAGGAAGAAACTTGATATGAGTAGGAGTTGTGAA[C/T]AAGCTAAGGAAAGACTTTCCTCATTGACAGGCACAAAAAGCCCATTTATA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa36879
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	3108	7964	35	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36693437)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35557957
GRCz11	19	35145077

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TAAAATTTGAGAATATGCCTATGGAACGACAGCAGGGTGATCTTGAAATT[A/T]AAGGTGCCGGCCATATGAGAAAAGATGGGCTTGAAACAGAGATCTTTCCT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa45679
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	3291	7964	35	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36692888)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35557408
GRCz11	19	35144528

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AAAACAAGGAACACATGCTAAAAGAAAAAAAAACGGGAGGTCATGGTTTT[G/T]AGGCAGAAGCTGAGGAAATGAAGGACAGCAAGACAGATGGATTTGATGTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa15741
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	3806	7964	35	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36691341)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35555861
GRCz11	19	35142981

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GAGRTTATGCCAGAGTCTGATAACACGCAAAAGGAAGTGGTGGAAGAATA[T/A]CCAATGGGTTCAGTGGAGAGACAACCTGAAGTTCTTCAAGTTAATATTGA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa11432
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	4082	7964	39	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798	Nonsense	248	248	4	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36689153)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35553673
GRCz11	19	35140793

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

ATGATGCCAGAGCAGAGGCACTATTAGCCCARCAGATGAGAGAGCATGAA[C/T]GACTGAAGAAAGAACAGAAAGWGAAAGAAGAGAAAATGGAAAAAGAGAGW

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa13865
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136	Nonsense	196	2818	2	41
ENSDART00000054274	Nonsense	5227	7964	56	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394	Nonsense	276	2898	4	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36669821)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35534341
GRCz11	19	35121461

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

AAACTGGGGAGATCCGCTCGGAACTGGAACAAAGACGGGGACAATTGTCC[C/T]ARGCTGAACAGCTGTGTACGGAGCTCAGCGCAATTGTGGCTGAACCATAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa23566
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136	Nonsense	214	2818	2	41
ENSDART00000054274	Nonsense	5245	7964	56	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394	Nonsense	294	2898	4	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36669767)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35534287
GRCz11	19	35121407

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CTGAACAGCTGTGTACGGAGCTCAGCGCAATTGTGGCTGAACCATATCTC[A/T]GAGACGAGTTGCACAAGAGACTGGAAAGCGTGAGCGGCCCCCTCAAGAAC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa36878
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136	Nonsense	330	2818	3	41
ENSDART00000054274	Nonsense	5361	7964	57	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394	Nonsense	410	2898	5	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36667807)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35532327
GRCz11	19	35119447

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GAGCATCTCTCCTGGCATCCCTTCCTGCGGGAGATGAGCGGTTAGCCTTA[C/T]AGACTCGCTTGAACAACTTACGGCAAGACTGGGAGGTCTTAAACCAACAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa32250
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136	Nonsense	503	2818	3	41
ENSDART00000054274	Nonsense	5534	7964	57	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394	Nonsense	583	2898	5	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36667288)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35531808
GRCz11	19	35118928

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GGCATCAGATCGAGGTTCAAGAGGCGCTTGGACCACAAGCTTGTAGCAAC[A/T]AAAGCCTGGAGCGTCTGCGAAGCCAACAGGAGCTGTTAAACTCTGTACAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa17558
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136		None	2818	None	41
ENSDART00000054274	Nonsense	6081	7964	63	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394		None	2898	None	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36630534)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35495054
GRCz11	19	35082174

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TGGCTAGCTGAGGTGGCCCAGAGACTGGCTGAGGTCTCAGTSCAGAGTTA[T/A]CAGCCGGAGCWCCTAGAGCAGCAGCACAAACACACACTGGTATGATTCTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa25094
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136	Nonsense	1113	2818	11	41
ENSDART00000054274	Nonsense	6253	7964	66	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394	Nonsense	1193	2898	13	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36626874)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35491394
GRCz11	19	35078514

KASP Assay ID:

554-7690.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGGTTGCTGATGCCAATCAGCGATACCGCCAAGCAGACGAGACCATCACA[C/T]AGAGAGTGCAGTTAGTGCAGGCTGCCATCCAAAGGTCACAGCAGGTACTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa36877
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136	Essential Splice Site	1345	2818	15	41
ENSDART00000054274	Essential Splice Site	6485	7964	70	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394	Essential Splice Site	1425	2898	17	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36621414)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35485934
GRCz11	19	35073054

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CTTTAGTGTGCTGTATGTGCTCTGACCATCGTCATCTCTCTATCATTTCA[G/T]TTTCATGATAAGATGGACCCTCTGTTGGAGACTCTGGAAGGCGCAGTCCA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa23565
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136	Nonsense	1512	2818	17	41
ENSDART00000054274	Nonsense	6652	7964	72	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394	Nonsense	1592	2898	19	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36618359)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35482879
GRCz11	19	35069999

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AGGCCATTAAAGCAGAGACAGATGGGCTGAGGGAGGAACTGGAGATCGTA[C/T]GAACACTCGGAGCTGACCTCATCTTTGCCTGCGGAGAGACTGAAAAACCA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa43317
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000007535		None	134	None	3
ENSDART00000039136	Essential Splice Site	2220	2818	30	41
ENSDART00000054274	Essential Splice Site	7360	7964	85	97
ENSDART00000140075		None	1586	None	34
ENSDART00000144798		None	248	None	4
ENSDART00000146394	Essential Splice Site	2300	2898	32	43
ENSDART00000147054		None	180	None	4

Genomic Location (Zv9):

Chromosome 19 (position 36609092)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	19	35473612
GRCz11	19	35060732

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CGCCCTGTCCGTTTCAAAGCAGACGCGCCTCCAGCAGGCTCTTAAACAGG[T/C]ACGGCTGACCCTTATTTACACTTCTATTGTAATGCTTTTGAAAGACGTCT

Associated Phenotype:

Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for MACF1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: