Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hbp1
- Ensembl ID:
- ENSDARG00000028517
- ZFIN ID:
- ZDB-GENE-050522-414
- Description:
- HMG box-containing protein 1 [Source:RefSeq peptide;Acc:NP_001019602]
- Human Orthologue:
- HBP1
- Human Description:
- HMG-box transcription factor 1 [Source:HGNC Symbol;Acc:23200]
- Mouse Orthologue:
- Hbp1
- Mouse Description:
- high mobility group box transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:894659]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa16526 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16526
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000029067 | Nonsense | 92 | 481 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 25 (position 3522054)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 3340159 GRCz11 25 3465893 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTGTRTCTCATCACGAGGAAGGGCCCGGCAGYGACTCSCACACAAACTG[G/A]CTGACCGAACTGGCCAACATCGCCACCAGCCCCCAAAGYCCCCTGCTCCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
