zgc:112352

Ensembl ID:
ENSDARG00000028513
ZFIN ID:
ZDB-GENE-050706-137
Description:
coronin-7 [Source:RefSeq peptide;Acc:NP_001025407]
Human Orthologue:
CORO7
Human Description:
coronin 7 [Source:HGNC Symbol;Acc:26161]
Mouse Orthologue:
Coro7
Mouse Description:
coronin 7 Gene [Source:MGI Symbol;Acc:MGI:1926135]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40009 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031195 Nonsense 82 661 3 20
Genomic Location (Zv9):
Chromosome 3 (position 12782972)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12227380
GRCz11 3 12380323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGCGACTCATGCAGCTCACCGAAAACTTCATTGTGCCCATCAGCTA[C/A]CAGGTGCCCCGCAAGGTGAGGATTAACACACCACAGCTTTTTTATCAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link