zgc:101035

Ensembl ID:
ENSDARG00000028442
ZFIN ID:
ZDB-GENE-040912-80
Description:
Miro domain-containing protein C1orf89 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q66JN8]
Human Orthologue:
C1orf89
Human Description:
chromosome 1 open reading frame 89 [Source:HGNC Symbol;Acc:28127]
Mouse Orthologue:
6330545A04Rik
Mouse Description:
RIKEN cDNA 6330545A04 gene Gene [Source:MGI Symbol;Acc:MGI:1923416]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44641 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029553 Nonsense 229 252 5 5
ENSDART00000128756   None 172 5 5
ENSDART00000144864 Nonsense 134 140 3 3
Genomic Location (Zv9):
Chromosome 6 (position 41382155)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41453755
GRCz11 6 41451291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGCACCTCTGCTAAATGCCCTTGTGGAAAACTTGTGGCACCAGGATTG[T/A]ATGGCCGCTTCATCTGTCTCCATCTCTCCACAGGCTGCTCTCAGAGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link