
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fkbp5
- Ensembl ID:
- ENSDARG00000028396
- ZFIN ID:
- ZDB-GENE-030616-630
- Description:
- peptidyl-prolyl cis-trans isomerase FKBP5 [Source:RefSeq peptide;Acc:NP_998314]
- Human Orthologue:
- FKBP5
- Human Description:
- FK506 binding protein 5 [Source:HGNC Symbol;Acc:3721]
- Mouse Orthologue:
- Fkbp5
- Mouse Description:
- FK506 binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:104670]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12885 | Essential Splice Site | Available for shipment | Available now |
sa15952 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12885
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028373 | Essential Splice Site | 280 | 453 | 8 | 11 |
The following transcripts of ENSDARG00000028396 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 41041324)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 41112924 GRCz11 6 41110460 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AYTGGAACGTGCKGTTTTAGTCAAACAAAAAGGGACACAGTATTTCAAGG[T/A]TCGTCTACACTTTTATCTTGGCATTTATTCTAGTTGCTAWMTTTAATGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15952
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028373 | Nonsense | 283 | 453 | 9 | 11 |
The following transcripts of ENSDARG00000028396 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 41042568)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 41114168 GRCz11 6 41111704 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAGCAGTCGTCAAACTGACATTTTGTTTACACTGTCCACTCAGGCAGGA[C/T]GATACAACTATGCTGTAATTCAGTACCAGCGGATCGTAAACTGGTTGGAG
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: