si:ch211-10e8.3

Ensembl ID:
ENSDARG00000028389
ZFIN ID:
ZDB-GENE-040724-117
Description:
Novel Ras family member [Source:UniProtKB/TrEMBL;Acc:Q7T015]
Human Orthologue:
RAB44
Human Description:
RAB44, member RAS oncogene family [Source:HGNC Symbol;Acc:21068]
Mouse Orthologue:
Rab44
Mouse Description:
RAB44, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:3045302]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14499 Nonsense Available for shipment Available now
sa13184 Nonsense Available for shipment Available now
sa12366 Nonsense Available for shipment Available now
sa45263 Nonsense Mutation detected in F1 DNA During 2018
sa33928 Nonsense Mutation detected in F1 DNA During 2018
sa31535 Nonsense Available for shipment Available now
sa13349 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028292 Nonsense 450 1952 1 9
ENSDART00000137283   None 166 None 5
Genomic Location (Zv9):
Chromosome 6 (position 40997125)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41068725
GRCz11 6 41066261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTCCAGATGAATCTACATTACAAAACATGAAAGATGGAGCTGAAGAA[C/T]AGGAGAAGGAAATATGTCTGGAKAATGATGTTGGTCTTGTTGAAGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028292 Nonsense 641 1952 1 9
ENSDART00000137283   None 166 None 5
Genomic Location (Zv9):
Chromosome 6 (position 40996551)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41068151
GRCz11 6 41065687
KASP Assay ID:
2259-7945.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGCATCATTCCTGGAGATTCTCACAACGAAGAGGYAAACTCAAAGT[C/A]AAGTCCAGTTGTTCAGAGGAGAAAAATGGGCTCAACTCGAAGACCTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028292 Nonsense 839 1952 1 9
ENSDART00000137283   None 166 None 5
Genomic Location (Zv9):
Chromosome 6 (position 40995958)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41067558
GRCz11 6 41065094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCTACAAATGTCGAGGAAGATACTTCAGGAGACACAGACACAATTTTC[A/T]AGCAGAGTAACATCAACGTTGTTCATGAAGAWATTTATAGAGGGGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028292 Nonsense 1059 1952 1 9
ENSDART00000137283   None 166 None 5
Genomic Location (Zv9):
Chromosome 6 (position 40995297)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41066897
GRCz11 6 41064433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCAGAGAGAAGAATCCAAGGTAAAGAATAGAGATAATGAGGCAGGGT[C/A]AGAAGAGGAAAACACAGAAACACATTCAAAAGACCAGGAACAAAATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028292 Nonsense 1073 1952 1 9
ENSDART00000137283   None 166 None 5
Genomic Location (Zv9):
Chromosome 6 (position 40995256)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41066856
GRCz11 6 41064392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCAGGGTCAGAAGAGGAAAACACAGAAACACATTCAAAAGACCAGGAA[C/T]AAAATGTGGCAAAAGACAATATGAATATAATAGATAATGTCAATGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028292 Nonsense 1621 1952 1 9
ENSDART00000137283   None 166 None 5
Genomic Location (Zv9):
Chromosome 6 (position 40993612)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41065212
GRCz11 6 41062748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGAAGATGAAGACAAAGTAGATCAGAAGACAGAGTCAAACAAAGAA[G/T]AAATAACGGAGGGGTCGCTAGTGCATAATATCACAGAAGACCCTCCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028292 Essential Splice Site 1925 1952 9 9
ENSDART00000137283   None 166 None 5
Genomic Location (Zv9):
Chromosome 6 (position 40989407)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41061007
GRCz11 6 41058543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAATGTGYCGTCTCTGCTTGCATAATGTGTAATTTGYCTTTGCTGYT[A/C]GGTTGTTAGTGCAGCGCAAGAGAAAAAGGGAGGAACACACAACGCTGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link