sult2st3

Ensembl ID:
ENSDARG00000028367
ZFIN ID:
ZDB-GENE-061117-4
Description:
sulfotransferase family 2, cytosolic sulfotransferase 3 [Source:RefSeq peptide;Acc:NP_001071636]
Human Orthologues:
SULT2A1, SULT2B1
Human Descriptions:
sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 [Source:H
sulfotransferase family, cytosolic, 2B, member 1 [Source:HGNC Symbol;Acc:11459]
Mouse Orthologues:
2810007J24Rik, Sult2a1, Sult2a2, Sult2a3, Sult2a4, Sult2a5, Sult2a6, Sult2b1
Mouse Descriptions:
RIKEN cDNA 2810007J24 gene Gene [Source:MGI Symbol;Acc:MGI:1924221]
sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 Gene [Source:MGI Symb
sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 2 Gene [Source:MGI Symb
sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 3 Gene [Source:MGI Symb
sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4 Gene [Source:MGI Symb
sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 5 Gene [Source:MGI Symb
sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 6 Gene [Source:MGI Symb
sulfotransferase family, cytosolic, 2B, member 1 Gene [Source:MGI Symbol;Acc:MGI:1926342]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22938 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037797 Nonsense 185 288 4 7
Genomic Location (Zv9):
Chromosome 16 (position 47824749)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45022945
GRCz11 16 44989661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGCTGGCGAAACCCAGAGCTCAAAGACAGAATTCTGTACGTCACCTA[T/A]GAAGAAATGCTTCAGGTAAAGTGAAATTGTGCCACTCACTCAGAGATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link