sult1st1

Ensembl ID:
ENSDARG00000028275
ZFIN ID:
ZDB-GENE-030131-2144
Description:
Cytosolic sulfotransferase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PH37]
Human Orthologues:
SULT1A1, SULT1A2, SULT1A3, SULT1A4, SULT1B1, SULT1C3, SULT1E1
Human Descriptions:
sulfotransferase family 1E, estrogen-preferring, member 1 [Source:HGNC Symbol;Acc:11377]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 [Source:HGNC Symbol;Acc:11453]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 [Source:HGNC Symbol;Acc:11454]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 [Source:HGNC Symbol;Acc:11455]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 [Source:HGNC Symbol;Acc:30004]
sulfotransferase family, cytosolic, 1B, member 1 [Source:HGNC Symbol;Acc:17845]
sulfotransferase family, cytosolic, 1C, member 3 [Source:HGNC Symbol;Acc:33543]
Mouse Orthologues:
Sult1a1, Sult1b1, Sult1d1, Sult1e1
Mouse Descriptions:
sulfotransferase family 1A, phenol-preferring, member 1 Gene [Source:MGI Symbol;Acc:MGI:102896]
sulfotransferase family 1B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2136282]
sulfotransferase family 1D, member 1 Gene [Source:MGI Symbol;Acc:MGI:1926341]
sulfotransferase family 1E, member 1 Gene [Source:MGI Symbol;Acc:MGI:98431]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38711 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038924 Nonsense 189 299 6 8
Genomic Location (Zv9):
Chromosome 8 (position 48653751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46492009
GRCz11 8 46499888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTTGGTCCTTGGTATGACCATGTGAATGGATACTGGGAAAAAAAA[C/T]AGACGTACTCTAACCTATTATACTTGTTCTATGAGGATTTGGTTGAAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link