
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ube2v2
- Ensembl ID:
- ENSDARG00000028198
- ZFIN ID:
- ZDB-GENE-040426-2919
- Description:
- Ubiquitin-conjugating enzyme E2 variant 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6PEH5]
- Human Orthologue:
- UBE2V2
- Human Description:
- ubiquitin-conjugating enzyme E2 variant 2 [Source:HGNC Symbol;Acc:12495]
- Mouse Orthologues:
- Gm10088, Ube2v2
- Mouse Descriptions:
- predicted gene 10088 Gene [Source:MGI Symbol;Acc:MGI:3641695]
- ubiquitin-conjugating enzyme E2 variant 2 Gene [Source:MGI Symbol;Acc:MGI:1917870]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15834 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15834
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026578 | Nonsense | 113 | 145 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 24 (position 37018683)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 35635945 GRCz11 24 35524042 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGGTGGAKGCACGTAGCATACCAATTCTAGCAAAATGGCAAAACTCATA[T/A]AGCATTAAAGTCGTTCTTCAAGAGCTAAGGCGTCTTATGATGTCCAAAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: