sumo3a

Ensembl ID:
ENSDARG00000028119
ZFIN ID:
ZDB-GENE-040426-2133
Description:
Small ubiquitin-related modifier 3-like [Source:UniProtKB/Swiss-Prot;Acc:Q6NV25]
Mouse Orthologue:
Sumo3
Mouse Description:
SMT3 suppressor of mif two 3 homolog 3 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1336201]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15762 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035905 Nonsense 47 94 2 4
ENSDART00000130411 Nonsense 47 94 2 5

The following transcripts of ENSDARG00000028119 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 10983597)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10837223
GRCz11 6 11072650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAAATTAAAAGGCACACGCCACTCAGTAAATTAATGAAAGCGTACTG[C/A]GAGAGACAGGTAAGAATCAGATCAAAATAWTTWAACCATAGCACTGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link