zgc:162337

Ensembl ID:
ENSDARG00000028098
ZFIN ID:
ZDB-GENE-050309-15
Description:
hypothetical protein LOC503885 [Source:RefSeq peptide;Acc:NP_001070714]
Human Orthologue:
FUT9
Human Description:
fucosyltransferase 9 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:4020]
Mouse Orthologue:
Fut9
Mouse Description:
fucosyltransferase 9 Gene [Source:MGI Symbol;Acc:MGI:1330859]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18237 Nonsense Available for shipment Available now
sa38675 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034740 Nonsense 88 372 2 2
Genomic Location (Zv9):
Chromosome 8 (position 14020945)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13466289
GRCz11 8 13503994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCTCTGGTTCTGGCCTGAAAATTACTTCTTTGATTTCAGTGACTGT[A/T]AAACCATWTACAATATTGATGGTTGTCATTTGACCGACAATAGATCMCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034740 Nonsense 328 372 2 2
Genomic Location (Zv9):
Chromosome 8 (position 14021665)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13467009
GRCz11 8 13504714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCTGGACAAGGATGAAACTGCCTATCGCAGGTTCTTCAATTGGAGG[A/T]AACATCTCTCTCCAACCCCTCATTTGATTCAGAAAACACAAGAGTTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link