zbtb2b

Ensembl ID:
ENSDARG00000028086
ZFIN ID:
ZDB-GENE-040426-2753
Description:
zinc finger and BTB domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_998580]
Human Orthologue:
ZBTB2
Human Description:
zinc finger and BTB domain containing 2 [Source:HGNC Symbol;Acc:20868]
Mouse Orthologue:
Zbtb2
Mouse Description:
zinc finger and BTB domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2685949]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43449 Missense, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036942 Missense 419 538 3 3
ENSDART00000078093 Missense 419 538 3 3
ENSDART00000128666 Nonsense 206 215 4 4
Genomic Location (Zv9):
Chromosome 20 (position 26434715)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26506018
GRCz11 20 26405108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATACGGGCAAGCCGTACCGCTGCAGCGCCTGTGGCAAGAGCTTCTGCC[G/T]AGCCAATCAGGCGGCGCGGCACGTCTGCATGAATCTGGGCTCAGAGCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link