
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
traf6
- Ensembl ID:
- ENSDARG00000028058
- ZFIN ID:
- ZDB-GENE-030131-5735
- Description:
- TNF receptor-associated factor 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6IWL4]
- Human Orthologue:
- TRAF6
- Human Description:
- TNF receptor-associated factor 6 [Source:HGNC Symbol;Acc:12036]
- Mouse Orthologue:
- Traf6
- Mouse Description:
- TNF receptor-associated factor 6 Gene [Source:MGI Symbol;Acc:MGI:108072]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa244 | Nonsense | F2 line generated | During 2018 |
sa151 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa244
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000038273 | Nonsense | 19 | 542 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 7 (position 50190596)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 48460832 GRCz11 7 48733608 - KASP Assay ID:
- 554-2571.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTGCAAYGACGTGGACAAGTCCAGCTTCGAYGATGTCTGCTGTGACAGC[G/T]GACACTCGAGTTGTGCTGCAGCTATGGAGAAGGAGAGGGAGTCGTTTCTG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa151
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000038273 | Nonsense | 166 | 542 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 7 (position 50185417)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 48455653 GRCz11 7 48728429 - KASP Assay ID:
- 554-0746.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGAAACACTTGTCTCAGTGCAGGTTTGCCACTGCGCCGTGCCCTCAATG[T/A]CAGGAGTCTGTTCCCATAAGCCACCTGGATGAACATAAGAGCCAGCATTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: