zgc:86757

Ensembl ID:
ENSDARG00000028027
ZFIN ID:
ZDB-GENE-040625-139
Description:
hypothetical protein LOC415223 [Source:RefSeq peptide;Acc:NP_001002133]
Human Orthologues:
TRIM54, TRIM55, TRIM63
Human Descriptions:
tripartite motif-containing 54 [Source:HGNC Symbol;Acc:16008]
tripartite motif-containing 55 [Source:HGNC Symbol;Acc:14215]
tripartite motif-containing 63 [Source:HGNC Symbol;Acc:16007]
Mouse Orthologues:
Trim54, Trim55, Trim63
Mouse Descriptions:
tripartite motif-containing 54 Gene [Source:MGI Symbol;Acc:MGI:1889623]
tripartite motif-containing 55 Gene [Source:MGI Symbol;Acc:MGI:3036269]
tripartite motif-containing 63 Gene [Source:MGI Symbol;Acc:MGI:2447992]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40658 Nonsense Mutation detected in F1 DNA During 2018
sa4 Nonsense Confirmed mutation in F2 line During 2018
sa14274 Nonsense Available for shipment Available now
sa7 Nonsense Confirmed mutation in F2 line During 2018
sa6 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa40658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038133 Nonsense 71 345 1 1
Genomic Location (Zv9):
Chromosome 6 (position 15553029)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15526261
GRCz11 6 15653201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAAAATCCCTACCACTTCTCTGGAGGTATCTTCCGATGCCCTACTTG[T/A]CGCTTCGAGGTGGTTCTGGACCGCCATGGTGTCTACGGCCTGCAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038133 Nonsense 113 345 1 1
Genomic Location (Zv9):
Chromosome 6 (position 15552904)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15526136
GRCz11 6 15653076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTACAAGCAGCAGTTGGAGAAAGGAAGCAATGCCCTTGAGCCCCCTT[T/A]GAAATCCAAAGAAACTAAAGAGCCCATGTGTGATGTTCACGAAGAGGAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038133 Nonsense 120 345 1 1
Genomic Location (Zv9):
Chromosome 6 (position 15552884)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15526116
GRCz11 6 15653056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAGGAAGCAATGCCCTTGARCCCCCTTTGAAATCCAAAGAAACWAAA[G/T]AGCYCATGTGTGATGTTCACGAAGAGGAAAAGATCAACATCTACTGCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038133 Nonsense 282 345 1 1
Genomic Location (Zv9):
Chromosome 6 (position 15552398)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15525630
GRCz11 6 15652570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGACGATGGACAACAACAATACAGCAGAGTTCCTCATTGCTGCTAAA[C/T]AGCTTCTCATCGAAGCCAAAGATGCAACCAAGAACTCTCATCTACAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038133 Nonsense 286 345 1 1
Genomic Location (Zv9):
Chromosome 6 (position 15552386)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15525618
GRCz11 6 15652558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAACAATACAGCAGAGTTCCTCATTGCTGCTAAACAGCTTCTCATC[G/T]AAGCCAAAGATGCAACCAAGAACTCTCATCTACAGAGGCCAGAGCCTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link