zgc:92869

Ensembl ID:
ENSDARG00000027984
ZFIN ID:
ZDB-GENE-040718-184
Description:
maleylacetoacetate isomerase isoform 1 [Source:RefSeq peptide;Acc:NP_001025442]
Human Orthologue:
GSTZ1
Human Description:
glutathione transferase zeta 1 [Source:HGNC Symbol;Acc:4643]
Mouse Orthologue:
Gstz1
Mouse Description:
glutathione transferase zeta 1 (maleylacetoacetate isomerase) Gene [Source:MGI Symbol;Acc:MGI:134185

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42995 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42996 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075529 Essential Splice Site 74 216 5 9
Genomic Location (Zv9):
Chromosome 17 (position 45273794)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44993595
GRCz11 17 45107360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTCAGAAATTGTTTTAGGTTTACTTTTAGTTTTGCTATTGAACACA[G/A]TTGGCCATCATCCAGTACATTGAGGAAACCCGTCCAGAGCCCCGCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075529 Nonsense 112 216 5 9
Genomic Location (Zv9):
Chromosome 17 (position 45273909)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44993710
GRCz11 17 45107475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAGAGCTCATGTCCGCATCATCTGCGACATCATCGCCTCTGGGATC[C/T]AGCCTCTTCAAGTGAGTGAGACCAGACGGAATCTGAAATCACATACTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link