SLC44A4

Ensembl ID:
ENSDARG00000027875
Description:
solute carrier family 44, member 4 [Source:HGNC Symbol;Acc:13941]
Human Orthologue:
SLC44A4
Human Description:
solute carrier family 44, member 4 [Source:HGNC Symbol;Acc:13941]
Mouse Orthologue:
Slc44a4
Mouse Description:
solute carrier family 44, member 4 Gene [Source:MGI Symbol;Acc:MGI:1917379]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23407 Essential Splice Site Available for shipment Available now
sa30707 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030030 Essential Splice Site 392 720 14 23
Genomic Location (Zv9):
Chromosome 19 (position 994824)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150433.1 5706
GRCz11 19 958120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTGTGCTGCTGTTGGTGTGTGTGTCGTACTGGGGAATCACAGCGCTG[T/C]ATCCTTAATCAATAAACACACTGCAGATCTAAACAGAATGATTAATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030030 Nonsense 646 720 21 23
Genomic Location (Zv9):
Chromosome 19 (position 988955)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1315507
GRCz11 19 952172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCACAACATTGATATCATGAGCACATCAGAATATTGAACAATGCACAT[C/T]AATCCTTTGTGACAAATTTATTTACAACTTTTAATGTATTTAATGATCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Telomere length: Genome-wide association identifies OBFC1 as a locus involved in human leukocyte telomere biology. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link