PAPLN (1 of 2)

Ensembl ID:
ENSDARG00000027867
Description:
papilin, proteoglycan-like sulfated glycoprotein [Source:HGNC Symbol;Acc:19262]
Human Orthologue:
PAPLN
Human Description:
papilin, proteoglycan-like sulfated glycoprotein [Source:HGNC Symbol;Acc:19262]
Mouse Orthologue:
Papln
Mouse Description:
papilin, proteoglycan-like sulfated glycoprotein Gene [Source:MGI Symbol;Acc:MGI:2386139]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36539 Nonsense Mutation detected in F1 DNA During 2018
sa43012 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43011 Nonsense Mutation detected in F1 DNA During 2018
sa30699 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088185 Nonsense 47 1187 2 27
Genomic Location (Zv9):
Chromosome 17 (position 51715455)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51101565
GRCz11 17 51190600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGAATGCAGTCGCAGTTGTGGCGGCGGGGTGACCATGAGGACGAGG[C/T]GATGTGTAACTCACAGGTAAGAATCTTCATTTACACAGATGCCTCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088185 Essential Splice Site 191 1187 6 27
Genomic Location (Zv9):
Chromosome 17 (position 51704000)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51090110
GRCz11 17 51179145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTGCAGTCGGCTCAAAAACAGCTTCTCCATGCGCAACCTGCCCAAAG[G/A]TGAACTCTCACAACACTCACAAACTCTCTGTGTTAGATCTGACAACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088185 Nonsense 290 1187 9 27
Genomic Location (Zv9):
Chromosome 17 (position 51699286)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51085396
GRCz11 17 51174431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCAGCTGATCACTCAGGAGGTCAATGAGGGAGTGGATTATGAGTA[T/A]TATCTGCCTAACGGAGGCTCCACAGAGGGATATTACTGGAGCTACGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088185 Nonsense 1017 1187 24 27
Genomic Location (Zv9):
Chromosome 17 (position 51655718)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51041883
GRCz11 17 51130781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGGTGATCAAGCAGCTGACCGCAGATGATTCTGGACTTTATACCTG[C/A]ACAGTCACAGACGCACAGAAGTTTGAGGAGCGTCAGGTCCAGCTCAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link