
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-13c6.2
- Ensembl ID:
- ENSDARG00000027738
- ZFIN ID:
- ZDB-GENE-060503-666
- Description:
- hypothetical protein LOC100000125 [Source:RefSeq peptide;Acc:NP_001076407]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32259 | Nonsense | Available for shipment | Available now |
sa23587 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32259
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102726 | Nonsense | 67 | 344 | 6 | 9 |
ENSDART00000125579 | Nonsense | 105 | 804 | 5 | 13 |
ENSDART00000145356 | Nonsense | 105 | 536 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 43595311)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 42474359 GRCz11 19 42059498 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACCTGATCATGTCACTGAGGATGGCAAAAACGTGCTTAAGTACAAATGC[C/T]GAATGTGTTTTGTGGAGATGGACCTGTACAGTATGGTGACGCATATTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23587
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102726 | Nonsense | 109 | 344 | 7 | 9 |
ENSDART00000125579 | Nonsense | 147 | 804 | 6 | 13 |
ENSDART00000145356 | Nonsense | 147 | 536 | 7 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 43595518)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 42474566 GRCz11 19 42059705 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGAGCTGAAAAGGCCAGACTTGGTGACCTGGAATGACAATAATCTGAAA[C/T]AGCCGGGTCTCGTGGTCAGAGCCAAAGCTGCAGTCGTGGAGAAGCACGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: