zgc:165539

Ensembl ID:
ENSDARG00000027639
ZFIN ID:
ZDB-GENE-030131-5478
Description:
hypothetical protein LOC564373 [Source:RefSeq peptide;Acc:NP_001104646]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18307 Nonsense Available for shipment Available now
sa34890 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7337 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029122 Nonsense 46 529 1 3
ENSDART00000132207 Nonsense 154 637 3 5
ENSDART00000134502   None 189 None 2
ENSDART00000146761   None 181 None 2

The following transcripts of ENSDARG00000027639 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21625167)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21586581
GRCz11 10 21543962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCAGCTTTGCTTTRAAGACTGGAGTTTCTGGCCAGTCCACWAATGAT[C/T]AGAGCTCTCCTAGTCTGTCTASTTCYGTTTCTCAAGGTACCACCTATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029122 Essential Splice Site 167 529 1 3
ENSDART00000132207 Essential Splice Site 275 637 3 5
ENSDART00000134502   None 189 None 2
ENSDART00000146761   None 181 None 2

The following transcripts of ENSDARG00000027639 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21624801)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21586215
GRCz11 10 21543596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCCAAGTTGTTACTAGTCCGTTGACACCTGGGCCAGGTTCAAAGCAG[G/A]TTACCTCTGTCTATACAACCCAGACCGGATCCTCTGCCCCTTTCACTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029122 Missense 278 529 2 3
ENSDART00000132207 Missense 386 637 4 5
ENSDART00000134502   None 189 None 2
ENSDART00000146761   None 181 None 2

The following transcripts of ENSDARG00000027639 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21624296)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21585710
GRCz11 10 21543091
KASP Assay ID:
554-4167.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCSATAYGTATCTGTATYATTGCCCCAAAGTGTTACTAGTCAGTCGA[C/T]GGCAGTGCCAAGTTCAAAGCAGATAACCTCCATCTATACCACCSAGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link