adra1ab

Ensembl ID:
ENSDARG00000027638
ZFIN ID:
ZDB-GENE-060503-384
Description:
Novel protein similar to vertebrate adrenergic, alpha receptor family [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologue:
ADRA1A
Human Description:
adrenergic, alpha-1A-, receptor [Source:HGNC Symbol;Acc:277]
Mouse Orthologue:
Adra1a
Mouse Description:
adrenergic receptor, alpha 1a Gene [Source:MGI Symbol;Acc:MGI:104773]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41633 Nonsense Mutation detected in F1 DNA During 2018
sa30935 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037668 Nonsense 424 431 2 2
ENSDART00000141764 Nonsense 424 427 2 2
ENSDART00000037668 Nonsense 424 431 2 2
ENSDART00000141764 Nonsense 424 427 2 2
Genomic Location (Zv9):
Chromosome 10 (position 19030085)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19042431
GRCz11 10 18999865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAACCTGACACATCTCTGAGTCTCAAGGTTCATCAGGTTTCCATATG[T/A]AAGATAGATGGTGAGCCTGTGTGAAATGATTTTTGACTTTGTGAATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037668 Nonsense 424 431 2 2
ENSDART00000141764 Nonsense 424 427 2 2
ENSDART00000037668 Nonsense 424 431 2 2
ENSDART00000141764 Nonsense 424 427 2 2
Genomic Location (Zv9):
Chromosome 10 (position 19030085)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19042431
GRCz11 10 18999865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAACCTGACACATCTCTGAGTCTCAAGGTTCATCAGGTTTCCATATG[T/A]AAGATAGATGGTGAGCCTGTGTGAAATGATTTTTGACTTTGTGAATCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link