zgc:63670

Ensembl ID:
ENSDARG00000027602
ZFIN ID:
ZDB-GENE-040426-1227
Description:
Leucine-rich repeat and fibronectin type III domain-containing protein 1 [Source:UniProtKB/Swiss-Pro
Human Orthologue:
LRFN1
Human Description:
leucine rich repeat and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:29290]
Mouse Orthologue:
Lrfn1
Mouse Description:
leucine rich repeat and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:213

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8956 Nonsense Mutation detected in F1 DNA During 2018
sa10889 Nonsense Available for shipment Available now
sa42629 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099023 Nonsense 231 584 2 5
ENSDART00000124704 Nonsense 231 742 2 5
Genomic Location (Zv9):
Chromosome 15 (position 45463224)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45896191
GRCz11 15 46111352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGCTTTTCCAGCACGCGCAGGTTCTGTCCGAGCCCAAGACTTCCAGCT[C/A]GTCCAGGCTGWCGGTCAGCTTYGGRGGAAACCCTCTGYACTGTAACTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099023 Nonsense 339 584 3 5
ENSDART00000124704 Nonsense 339 742 3 5
Genomic Location (Zv9):
Chromosome 15 (position 45468104)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45901071
GRCz11 15 46116232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTTCCCGGACGGCAAACTGGTGCACAACAACTCCCGCACCMTTTTATA[C/A]GACAACGGCACGCTGGACATCCTGATCACCACACTGAAGGACAGCGGYGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099023 Nonsense 443 584 3 5
ENSDART00000124704 Nonsense 443 742 3 5
Genomic Location (Zv9):
Chromosome 15 (position 45468416)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45901383
GRCz11 15 46116544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCATACACTGGCCCTCAGAGAGACACATTCCTGGCATCCGCATGTA[C/A]CAGATCCAGTACAACAGCACTGTTGATGATACACTCGTCTACAGGTACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link