PAK6 (1 of 2)

Ensembl ID:
ENSDARG00000027564
Description:
p21 protein (Cdc42/Rac)-activated kinase 6 [Source:HGNC Symbol;Acc:16061]
Human Orthologue:
PAK6
Human Description:
p21 protein (Cdc42/Rac)-activated kinase 6 [Source:HGNC Symbol;Acc:16061]
Mouse Orthologue:
Pak6
Mouse Description:
p21 protein (Cdc42/Rac)-activated kinase 6 Gene [Source:MGI Symbol;Acc:MGI:2679420]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42843 Nonsense Mutation detected in F1 DNA During 2018
sa9627 Nonsense Available for shipment Available now
sa45590 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103775 Nonsense 81 693 2 10
Genomic Location (Zv9):
Chromosome 17 (position 1607108)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2050057
GRCz11 17 2226870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTCCACAGACCATTGTGCGGGGCAGTATGATTGGCCACGGGGATTA[C/A]ATCTCTGCCATGTTGTCCGACATGAGCCGTCTGTCAGTCACCAGCTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103775 Nonsense 455 693 5 10
Genomic Location (Zv9):
Chromosome 17 (position 1620143)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2063092
GRCz11 17 2239905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACACAGCGGACGCGTGGTGGCCGTCAAGATGATGGAYYTGAGGAGA[C/T]AGCAGAGGAGAGAACTKCTCTTCAATGAGGTKAYACACACCACCMGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103775 Nonsense 590 693 8 10
Genomic Location (Zv9):
Chromosome 17 (position 1632708)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2075657
GRCz11 17 2252470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGGAACGCCGTACTGGATGGCTCCTGAAGTCATCTCCAAATCTCCATA[C/A]GGAACTGAGGTACAGATCAACAAAACAAATACACATCACTATGTGTCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link