accn2a

Ensembl ID:
ENSDARG00000027512
ZFIN ID:
ZDB-GENE-040513-1
Description:
Amiloride-sensitive cation channel 2-A, neuronal [Source:UniProtKB/Swiss-Prot;Acc:Q708S8]
Human Orthologue:
ACCN3
Human Description:
amiloride-sensitive cation channel 3 [Source:HGNC Symbol;Acc:101]
Mouse Orthologues:
Accn2, Accn3
Mouse Descriptions:
amiloride-sensitive cation channel 2, neuronal Gene [Source:MGI Symbol;Acc:MGI:1194915]
amiloride-sensitive cation channel 3 Gene [Source:MGI Symbol;Acc:MGI:2159339]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43763 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028603 Nonsense 508 557 9 10
ENSDART00000140236 Nonsense 508 557 9 10
Genomic Location (Zv9):
Chromosome 22 (position 6995121)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 7018449
GRCz11 22 7048295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGGTGATCAAGTTCAAACTCTGTCGCTGCGCCAAGAAGAAACACCAA[C/T]GAAGCAACAACAACGAGCGAGGAGCCGTTCTCAGTCTGGACGACGTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link