
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mast1
- Ensembl ID:
- ENSDARG00000027497
- Human Orthologue:
- MAST1
- Human Description:
- microtubule associated serine/threonine kinase 1 [Source:HGNC Symbol;Acc:19034]
- Mouse Orthologue:
- Mast1
- Mouse Description:
- microtubule associated serine/threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1861901]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12456 | Nonsense | Available for shipment | Available now |
sa16788 | Nonsense | Available for shipment | Available now |
sa32768 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12456
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063938 | Nonsense | 78 | 1717 | 4 | 26 |
- Genomic Location (Zv9):
- Chromosome 1 (position 51849084)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 50696445 GRCz11 1 51340244 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGGCTGATGGCAGAYGCTGGTCTCTGGCTTCTCTTCCCTCGTCTGGATA[T/A]GGGACCAACACACCCAGCTCAACGGTACAAACTCATCCACACAGAGCTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16788
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063938 | Nonsense | 383 | 1717 | 12 | 26 |
- Genomic Location (Zv9):
- Chromosome 1 (position 51869710)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 50717071 GRCz11 1 51360870 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGGCACAGAGAAACTCGACAGCGCTTTGCAATGAAGAAGATCAACAAA[C/T]AGAACCTGATCCTGCGGAACCAGATCCAGCAGGCGTTCGTGGAGCGGGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32768
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063938 | Essential Splice Site | 652 | 1717 | 17 | 26 |
- Genomic Location (Zv9):
- Chromosome 1 (position 51877631)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 50724992 GRCz11 1 51368791 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGTTCATCCCTCATCTTGAGTCTGAAGAGGACACCAGCTACTTCGACAG[T/C]GAGGACACTCGCATTAGTCTGTCCTTGATAGTCATCGCTCTATATCTCTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: