uros

Ensembl ID:
ENSDARG00000027491
ZFIN IDs:
ZDB-GENE-040323-2, ZDB-GENE-040323-2
Description:
uroporphyrinogen-III synthase [Source:RefSeq peptide;Acc:NP_997993]
Human Orthologue:
UROS
Human Description:
uroporphyrinogen III synthase [Source:HGNC Symbol;Acc:12592]
Mouse Orthologue:
Uros
Mouse Description:
uroporphyrinogen III synthase Gene [Source:MGI Symbol;Acc:MGI:98917]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35380 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105309 Essential Splice Site 21 262 2 10
ENSDART00000130190 Essential Splice Site 21 262 2 11
Genomic Location (Zv9):
Chromosome 12 (position 50195918)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48758614
GRCz11 12 48674884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGAAAGAGCCGAGAGAGAGTGAAAGTGAAGCAGACCCTTATATTAAG[G/A]TAATCTCCTGTTATAATAATTATAATAATGTAAATAATGCGGTTTTAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link