zgc:56719

Ensembl ID:
ENSDARG00000027461
ZFIN ID:
ZDB-GENE-031118-200
Description:
UPF0585 protein C16orf13 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVJ8]
Human Orthologue:
C16orf13
Human Description:
chromosome 16 open reading frame 13 [Source:HGNC Symbol;Acc:14141]
Mouse Orthologue:
0610011F06Rik
Mouse Description:
RIKEN cDNA 0610011F06 gene Gene [Source:MGI Symbol;Acc:MGI:1915597]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44560 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035531 Essential Splice Site 168 235 4 7
Genomic Location (Zv9):
Chromosome 3 (position 17786585)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17907905
GRCz11 3 18057645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGTTGGACAGATACTGAAACCACAAGGATTACTTCTGACTTATGGGG[T/A]AATTTATTTACATTTTAAACTTAAGATTCTTGGATTGCTGCATTTGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link