
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
igf1ra
- Ensembl ID:
- ENSDARG00000027423
- ZFIN ID:
- ZDB-GENE-020503-1
- Description:
- insulin-like growth factor 1a receptor [Source:RefSeq peptide;Acc:NP_694500]
- Human Orthologue:
- IGF1R
- Human Description:
- insulin-like growth factor 1 receptor [Source:HGNC Symbol;Acc:5465]
- Mouse Orthologue:
- Igf1r
- Mouse Description:
- insulin-like growth factor I receptor Gene [Source:MGI Symbol;Acc:MGI:96433]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43094 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36640 | Nonsense | Available for shipment | Available now |
sa9079 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa36639 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43094
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010189 | Nonsense | 263 | 1405 | 3 | 21 |
The following transcripts of ENSDARG00000027423 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 20703814)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20934037 GRCz11 18 20923103 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGAAGCAGACAATGATAAAGCATGCGCCGCCTGCCAGCATTACTTTCAC[G/T]AGGACCGATGTGTCGAGGCCTGCCCGCCAGATACCTACAAGTTTGAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36640
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010189 | Nonsense | 524 | 1405 | 7 | 21 |
The following transcripts of ENSDARG00000027423 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 20695341)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20925564 GRCz11 18 20914630 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGATATCGACCGCCAGACTACAGAGACCTCATCAGCTTCATTGTGTATTA[C/A]AAGGAGGCGTAAGTACCAGTTACTATTGTAAACCTATTTTTCACTTCCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9079
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010189 | Essential Splice Site | 527 | 1405 | 7 | 21 |
The following transcripts of ENSDARG00000027423 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 20695332)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20925555 GRCz11 18 20914621 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCGYCAGACTACAGAGACCTCATCAGCTTCATTGTGTATTACAAGGAGGC[G/A]TAAGTACCAGTTACTATTGTAAACCTATTTTTCAYTWCCAGCTGGGATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36639
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010189 | Nonsense | 1201 | 1405 | 20 | 21 |
The following transcripts of ENSDARG00000027423 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 20672631)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20902854 GRCz11 18 20891920 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTGTATCACCTTGTTCCTCTTTTTGCAGGTCGTTTGGTGTGGTTTTAT[G/A]GGAGATCGCCACATTAGCCGAACAGCCCTACCAGGGCATGTCCAACGAGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Arthritis (juvenile idiopathic): Genome-wide association analysis of juvenile idiopathic arthritis identifies a new susceptibility locus at chromosomal region 3q13. (View Study)
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
- Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: