
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgpat
- Ensembl ID:
- ENSDARG00000027403
- ZFIN ID:
- ZDB-GENE-040426-1248
- Description:
- Zinc finger CCCH-type with G patch domain-containing protein [Source:UniProtKB/Swiss-Prot;Acc:Q7SXW2
- Human Orthologue:
- ZGPAT
- Human Description:
- zinc finger, CCCH-type with G patch domain [Source:HGNC Symbol;Acc:15948]
- Mouse Orthologue:
- Zgpat
- Mouse Description:
- zinc finger, CCCH-type with G patch domain Gene [Source:MGI Symbol;Acc:MGI:2449939]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21864 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21864
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037474 | Nonsense | 278 | 504 | 4 | 7 |
ENSDART00000129352 | Nonsense | 278 | 504 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 11 (position 12922401)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 12806810 GRCz11 11 12864469 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATGATGTTTCCTCCTCTTCCTCATCGGACTCCGAGGATGATGCTGAGTG[T/A]GATGGAGGCTATGCTAAAGGTGCTAATAGACACTTTTGTACATTTATACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
- Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: