zgpat

Ensembl ID:
ENSDARG00000027403
ZFIN ID:
ZDB-GENE-040426-1248
Description:
Zinc finger CCCH-type with G patch domain-containing protein [Source:UniProtKB/Swiss-Prot;Acc:Q7SXW2
Human Orthologue:
ZGPAT
Human Description:
zinc finger, CCCH-type with G patch domain [Source:HGNC Symbol;Acc:15948]
Mouse Orthologue:
Zgpat
Mouse Description:
zinc finger, CCCH-type with G patch domain Gene [Source:MGI Symbol;Acc:MGI:2449939]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21864 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037474 Nonsense 278 504 4 7
ENSDART00000129352 Nonsense 278 504 4 7
Genomic Location (Zv9):
Chromosome 11 (position 12922401)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12806810
GRCz11 11 12864469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGATGTTTCCTCCTCTTCCTCATCGGACTCCGAGGATGATGCTGAGTG[T/A]GATGGAGGCTATGCTAAAGGTGCTAATAGACACTTTTGTACATTTATACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link