vangl2

Ensembl ID:
ENSDARG00000027397
ZFIN ID:
ZDB-GENE-020507-3
Description:
Vang-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q8UVJ6]
Human Orthologue:
VANGL2
Human Description:
vang-like 2 (van gogh, Drosophila) [Source:HGNC Symbol;Acc:15511]
Mouse Orthologue:
Vangl2
Mouse Description:
vang-like 2 (van gogh, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2135272]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12076 Nonsense Available for shipment Available now
sa18862 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033316 Nonsense 219 526 4 8
ENSDART00000033316 Nonsense 219 526 4 8
Genomic Location (Zv9):
Chromosome 7 (position 6182842)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5217270
GRCz11 7 5338986
KASP Assay ID:
2259-8397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGGGTGCTGGAACCCAGAGAGCGYGACTACAGGGGMATTGTGGGATA[T/A]GCGGTGTCGCTGGTGGACGCGCTGCTYTTCATYCAGTATCTGGCGCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033316 Nonsense 219 526 4 8
ENSDART00000033316 Nonsense 219 526 4 8
Genomic Location (Zv9):
Chromosome 7 (position 6182842)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5217270
GRCz11 7 5338986
KASP Assay ID:
2259-8397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGGTGCTGGAACCCAGAGAGCGCGACTACAGGGGAATTGTGGGATA[T/A]GCGGTGTCGCTGGTGGACGCGCTGCTTTTCATCCAGTATCTGGCGCTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link