slc25a4

Ensembl ID:
ENSDARG00000027355
ZFIN ID:
ZDB-GENE-030131-5275
Description:
ADP/ATP translocase 1 [Source:RefSeq peptide;Acc:NP_999867]
Human Orthologue:
SLC25A4
Human Description:
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 [Source:
Mouse Orthologue:
Slc25a4
Mouse Description:
solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4 Gene [So

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39583 Nonsense Mutation detected in F1 DNA During 2018
sa12193 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030665 Nonsense 138 298 2 4
Genomic Location (Zv9):
Chromosome 1 (position 16419877)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16985045
GRCz11 1 17677982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGCAGGTGCGACCTCTCTGTGCTTCGTCTACCCTCTTGACTTCGCC[A/T]GAACAAGACTTGCTGCTGATATCGGCAAAGGTGCAGCCGAGAGAGAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030665 Nonsense 147 298 2 4
Genomic Location (Zv9):
Chromosome 1 (position 16419904)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16985072
GRCz11 1 17678009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTCTACCCTCTTGACTTCGCCAGAACAAGACTTGCTGCTGATATCGGC[A/T]AAGGTGCAGCCGAGAGAGAGTTCACCGGTCTYGGAAACTGTGTTGCCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link