zmym2

Ensembl ID:
ENSDARG00000027353
ZFIN ID:
ZDB-GENE-030131-2408
Description:
Novel protein similar to vertebrate zinc finger, MYM-type 2 (ZMYM2) [Source:UniProtKB/TrEMBL;Acc:B0S
Human Orthologues:
ZMYM2, ZMYM5
Human Descriptions:
zinc finger, MYM-type 2 [Source:HGNC Symbol;Acc:12989]
zinc finger, MYM-type 5 [Source:HGNC Symbol;Acc:13029]
Mouse Orthologues:
Zmym2, Zmym5
Mouse Descriptions:
zinc finger, MYM-type 2 Gene [Source:MGI Symbol;Acc:MGI:1923257]
zinc finger, MYM-type 5 Gene [Source:MGI Symbol;Acc:MGI:3041170]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18453 Nonsense Available for shipment Available now
sa34614 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102045 Nonsense 488 1357 4 22
ENSDART00000133469 Nonsense 488 1357 5 23
ENSDART00000136427   None 37 None 2
Genomic Location (Zv9):
Chromosome 9 (position 22481269)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21637055
GRCz11 9 21447924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGCGAACCACGTTTTACTCATAGACGGCCAGCAGAAACGCTTTTGCTG[T/A]CAAAATTGCATCAGGGACTATAAACAGGTCAGTGTCGTATGTTGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102045 Nonsense 1253 1357 21 22
ENSDART00000133469 Nonsense 1253 1357 22 23
ENSDART00000136427   None 37 None 2
Genomic Location (Zv9):
Chromosome 9 (position 22466872)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21622658
GRCz11 9 21433527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTGCTGTTTGCTGAAATGTCTTGTACGTGTTTTTCACAGAGCAAT[C/A]AGGAAGTAAGAGAAGACGTAAAGATTACTGTGACTCAAATTTTGATTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link