
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
btg1
- Ensembl ID:
- ENSDARG00000027249
- ZFIN ID:
- ZDB-GENE-010726-1
- Description:
- protein BTG1 [Source:RefSeq peptide;Acc:NP_956314]
- Human Orthologue:
- BTG1
- Human Description:
- B-cell translocation gene 1, anti-proliferative [Source:HGNC Symbol;Acc:1130]
- Mouse Orthologues:
- 4930430D24Rik, 4930525M21Rik, Btg1
- Mouse Descriptions:
- B-cell translocation gene 1, anti-proliferative Gene [Source:MGI Symbol;Acc:MGI:88215]
- RIKEN cDNA 4930430D24 gene Gene [Source:MGI Symbol;Acc:MGI:3588265]
- RIKEN cDNA 4930525M21 gene Gene [Source:MGI Symbol;Acc:MGI:3588262]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12374 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12374
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000033188 | Essential Splice Site | 48 | 182 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 4 (position 15612901)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 16555741 GRCz11 4 16544717 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGACAGACAGCTCCAGACATTCAGCCAGACCCTACAGGACATCCTGGCAG[G/A]TAATTAWCCACATTTATAAACGAATACGAGCTTCGTTGTATCCGCTTTCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: