wu:fc49b10

Ensembl ID:
ENSDARG00000027222
ZFIN ID:
ZDB-GENE-030131-3671
Description:
hypothetical protein LOC324948 [Source:RefSeq peptide;Acc:NP_001018317]
Human Orthologues:
GPR114, GPR56
Human Descriptions:
G protein-coupled receptor 114 [Source:HGNC Symbol;Acc:19010]
G protein-coupled receptor 56 [Source:HGNC Symbol;Acc:4512]
Mouse Orthologues:
Gpr114, Gpr56
Mouse Descriptions:
G protein-coupled receptor 114 Gene [Source:MGI Symbol;Acc:MGI:2685955]
G protein-coupled receptor 56 Gene [Source:MGI Symbol;Acc:MGI:1340051]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11235 Nonsense Available for shipment Available now
sa20956 Nonsense Available for shipment Available now
sa20955 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033921 Nonsense 44 648 2 13
Genomic Location (Zv9):
Chromosome 7 (position 30016561)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28409084
GRCz11 7 28680277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACAGAGACTTCAAKATGTGTGGAAAGTGGCTCCATGGCATCGCACCT[C/T]RAAATCTGGAATATGATTTRAAAACYGGCTGTGAAAGWATTGAMATTTYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033921 Nonsense 229 648 5 13
Genomic Location (Zv9):
Chromosome 7 (position 30015172)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28407695
GRCz11 7 28678888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCTAGCATATGCAATAATATACTTATGTGTTGCATTTCAGGCCCCT[C/T]GATTTGTAGACGCAAACACCATACCCTCCGTTTATATTCCATCAAGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033921 Nonsense 593 648 12 13
Genomic Location (Zv9):
Chromosome 7 (position 30007840)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28400363
GRCz11 7 28671556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTATGGAACCACATGGGCTCTGGGTTTCCTCGATTTTGGCCCTTTCT[C/A]AGAGGTCACCCTCTTTCTTTTCTGCATTATCAATTCCTTACAGGGTGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link