smad1

Ensembl ID:
ENSDARG00000027199
ZFIN ID:
ZDB-GENE-991119-8
Description:
Mothers against decapentaplegic homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q9I8V2]
Human Orthologues:
SMAD1, SMAD9
Human Descriptions:
SMAD family member 1 [Source:HGNC Symbol;Acc:6767]
SMAD family member 9 [Source:HGNC Symbol;Acc:6774]
Mouse Orthologues:
Smad1, Smad5, Smad9
Mouse Descriptions:
MAD homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109452]
MAD homolog 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1328787]
MAD homolog 9 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859993]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32713 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32712 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033566 Essential Splice Site 134 472 3 7
ENSDART00000125043 Essential Splice Site 134 473 3 7
Genomic Location (Zv9):
Chromosome 1 (position 35616729)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35176587
GRCz11 1 35908614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTCAGTTCTGATTCTCATGGTTGACATATTTCTCCCGTTTTCCTGCA[G/A]TGCTGCCACCCGTGCTGGTTCCACGAAACAGCGAGTTCAACGCTAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033566 Nonsense 259 472 4 7
ENSDART00000125043 Nonsense 259 473 4 7
Genomic Location (Zv9):
Chromosome 1 (position 35615927)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35175785
GRCz11 1 35907812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTGTCCCCAGCCAATGGACACTAACCTATTAGCTCCAAACTTGCCAT[T/A]GGAGATCAGCAACCGAACAGGTACCCTTCATTTAAATGCTAAAAGACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link