zgc:66260

Ensembl ID:
ENSDARG00000027182
ZFIN ID:
ZDB-GENE-040426-1581
Description:
E3 ubiquitin-protein ligase RNF25 [Source:RefSeq peptide;Acc:NP_957477]
Human Orthologue:
RNF25
Human Description:
ring finger protein 25 [Source:HGNC Symbol;Acc:14662]
Mouse Orthologue:
Rnf25
Mouse Description:
ring finger protein 25 Gene [Source:MGI Symbol;Acc:MGI:1890215]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31339 Nonsense Available for shipment Available now
sa17475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039466 Nonsense 196 513 8 10

The following transcripts of ENSDARG00000027182 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32811804)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32543114
GRCz11 3 32674828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGGAGTTAGCTGTTGTTTGCCCTGTCTGTCGAGAGTCTCTGACCTA[T/A]GATTTGGATGCCCTTCTTTCCTCGCCTGCTCCAGTTCTCTGTCAGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039466 Nonsense 297 513 10 10

The following transcripts of ENSDARG00000027182 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32816325)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32547635
GRCz11 3 32679349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCYTCCTCATCCCCAGATTCCACTAGCACAAYCCAAACCTCWCAAAAT[C/T]AGCACACTGCAGGCCAACCACAAAGAAAACACACAGGCGACTTTAAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link