zgc:55877

Ensembl ID:
ENSDARG00000027169
ZFIN ID:
ZDB-GENE-040426-2023
Description:
hypothetical protein LOC406343 [Source:RefSeq peptide;Acc:NP_998235]
Human Orthologue:
KPNA7
Human Description:
karyopherin alpha 7 (importin alpha 8) [Source:HGNC Symbol;Acc:21839]
Mouse Orthologue:
Kpna7
Mouse Description:
karyopherin alpha 7 (importin alpha 8) Gene [Source:MGI Symbol;Acc:MGI:2141165]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41661 Nonsense Mutation detected in F1 DNA During 2018
sa38800 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036906 Nonsense 13 520 1 10
Genomic Location (Zv9):
Chromosome 10 (position 25842660)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25246618
GRCz11 10 25217178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGAGATTCAAAATGCCTACAGAAAATCTTTCAGATAAACGCATGTCC[A/T]AGTTCAAAAATAAGGGCAAGGAGCCGACGGTGAGCTGAGCATCCATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036906 Essential Splice Site 70 520 3 10
Genomic Location (Zv9):
Chromosome 10 (position 25842325)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25246283
GRCz11 10 25216842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAGACCTCTCATTATTGCAGGACTCTTACAACTTGCTGTTTTTATTAA[G/A]GTCATCTGTACAACAATTGAAGAAATTGTTGCAAACGTGAACACTGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link