zgc:194845

Ensembl ID:
ENSDARG00000027153
ZFIN ID:
ZDB-GENE-080722-20
Description:
gamma-aminobutyric acid receptor, rho 3 [Source:RefSeq peptide;Acc:NP_001122232]
Mouse Orthologue:
Gabrr3
Mouse Description:
gamma-aminobutyric acid (GABA) receptor, rho 3 Gene [Source:MGI Symbol;Acc:MGI:3588203]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17132 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048430 Nonsense 377 472 9 9

The following transcripts of ENSDARG00000027153 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36391466)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35424168
GRCz11 10 35368028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACTAGCTTCCTTTCTCCTTGTTCCCTAAAACAGCTTCCAGYTTCCTA[C/A]GACGCGACTCAGGCGATGGCGTACGACGGCTGTTTTCACGACGACATCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link