ube2l3b

Ensembl ID:
ENSDARG00000027141
ZFIN ID:
ZDB-GENE-030131-662
Description:
ubiquitin-conjugating enzyme E2L 3b [Source:RefSeq peptide;Acc:NP_001076266]
Human Orthologue:
UBE2L3
Human Description:
ubiquitin-conjugating enzyme E2L 3 [Source:HGNC Symbol;Acc:12488]
Mouse Orthologue:
Ube2l3
Mouse Description:
ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI Symbol;Acc:MGI:109240]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40368 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004539 Essential Splice Site 104 154 3 4
ENSDART00000099602 Essential Splice Site 86 136 3 4
ENSDART00000146136 Essential Splice Site 140 190 3 4
Genomic Location (Zv9):
Chromosome 5 (position 14548031)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12845468
GRCz11 5 13345685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTCATTAGTGCAGAGAACTGGAAACCAGCCACCAAAACTGACCAAGG[T/C]AAGCCTGAAACAAACACACAAGGCAGACTTTACTAAAGCTCAGTCCTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link